Lord Byron Essay Research Paper Lord Byron free essay sample

Lord Byron Essay, Research Paper Lord Byron wrote a long verse form, published in cantos, about a pilgrim named Childe Harold who he modeled after himself. The journeys he goes on are similar to the 1s Lord Byron encounters in his life-time. The talker in Lord Byron? s? Childe Harold? s Pilgrimage? is Childe Harold. In Canto IV, he begins by discoursing his love for nature and goes on to apostrophise the ocean. In the first stanza, Childe Harold discusses the beauty he sees in nature. He finds pleasance and ecstasy in nature which he compares to a ? society, where none intrudes. ? He states that he? love non adult male the less, but nature more? significance that he does non detest adult male and turns to nature for comfort but alternatively prefers nature to adult male. He talks about the feelings he experiences when he is with nature and explains that he does non cognize how to show them but at the same clip, he can non hide his feelings. We will write a custom essay sample on Lord Byron Essay Research Paper Lord Byron or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Childe Harold begins his apostrophe of the ocean in the 2nd and 3rd stanzas. The 2nd stanza focal points on how adult male is unable to command the ocean. He comments that? 10 thousand fleets sweep over thee in vain? and yet adult male? s? control stops with the shore. ? Childe Harold uses a simile, comparing adult male? like a bead of rain? falling into the ocean? s deepness after the ocean decides to bust up him. The imagination in this stanza conveys the thought of a huge eternal ocean. Byron chooses his linguistic communication carefully, utilizing words like? watery field, ? ? bead of rain, ? and? bubbling groan. ? In the 3rd stanza, he looks back on his childhood and how he has ever viewed the ocean with joy and hilarity. He has neer feared the ocean and trusts it entirely. He describes playing in its bubbles and pleasing in the ocean? s surfs and surges. Byron changes his tone in the 4th stanza and pull back his earlier emotions. In this stanza, he switches from watery images to fiery images. He mentions a? torch, ? ? my midnight lamp, ? and? the freshness which in my spirit dwelt. ? Childe Harold saddens as he remarks on how his spirit is melting off. The local area network guage in this stanza gives the reader a sense of abjuration. The talker in the verse form dies in the last lines while saying that? the freshness which in my spirit dwelt is fliting, swoon, and low. ? A different storyteller takes charge in the last stanza and exclaims a farewell to the pilgrim Childe Harold. The storyteller repeats the word ? farewell? several times and comments that if the reader must retrieve anything, retrieve non the pilgrim but the moral of his verse form. Childe Harold chose to decease in the ocean, which he respected and cherished the most. He uses the verse form to convey the beauty he finds in nature and how of import it is to maintain it untasted by adult male? s catastrophic influences. There are many features of Romanticism that can be found in Lord Byron? s? Chile Harold? s Pilgrimage. ? He assumes the function of a Romantic poet by taking the stance of? a adult male talking to work forces? when he Tells everyone about his love for nature and the ocean. Lord Byron uses a originative and inventive manner to compose his verse form get downing with Childe Harold speech production and so holding a different storyteller terminal the verse form after Childe Harold dies. Lord Byron besides views nature in a psychological sense by detecting its cryptic forces and how it caused alterations. There was a definite relationship between Childe Harold? s head and the nature that surrounded him. Another manner this verse form resembles others of the Romantic Time period is that it involved a captivation with Childe Harold? s young person and artlessness. He played in the ocean as a kid and learned to non fear it. The verse form? Childe Harold? s Pilgrimage? written by Lord Byron deserves a rightful topographic point among the other Romantic verse forms. It expresses the tie between adult male, his head, and nature. The thoughts and ideas adult male lurchs across can be obtained through both what is out at that place in nature and what is inside his head. Both of those factors sum up the whole of Romantic thought. The moral of Lord Byron? s verse form is to go forth nature as unmarked as possible to continue its beauty and to non fear it but take pleasance in it. 31b

Food safety management systems Essays

Food safety management systems Essays Food safety management systems Essay Food safety management systems Essay 1.1 Enterobacteriaceae An increased consciousness and a better apprehension of the nutrient industry and its associated hazards with microbiological taints have been the consequence of the broad usage of nutrient safety direction systems in Ireland. Hazard Analysis Critical Control Point ( HACCP ) is the chief nutrient safety system used throughout nutrient industries. Although this system was introduced in the 1960 s it was merely in 1998 that the EU Hygiene of foodstuffs Regulations implemented this referential in all nutrient concerns in Europe ( Food Market Exchange 2001 ) . Microbiological controls are performed to guarantee the quality and safety of the nutrient merchandises. The patterned advance in scientific discipline and microbic engineering hold given a better apprehension of nutrient production, processing and saving and the nexus between the microscopic and macroscopic universe. This relation enables micro-organisms to be exhaustively examined and evaluated. Food borne unwellnesss are the mos t widespread public wellness jobs, making societal and economic loads along with human enduring. In order to seek cut downing the hazard of such unwellnesss and nutrient poisonings, hygiene steps are required in nutrient processing environments ( Microbiological hazard appraisal 2006 ) . The presence of Enterobacteriaceae in nutrient or food-contact surfaces in such environments serves as hygiene indexs. : Enterobacteriaceae are a big household of bacteriums that comprise of at least 34 genera, 149 species and 21 races. Cells are typically 0.3-1.8AÂ µm in length. ( Blackburn day of the month? ) They are rod shaped, Gram negative facultative anaerobes and are natural dwellers of bowels in both worlds and animate beings. They are found extensively throughout the dirt, H2O, on fruit, veggies and cereals. They play a considerable function in human wellness as many pathogens fall under this household which are known to do many infective diseases. Harmonizing to Kang et Al ( 2007 ) a minute sum of 10 settlement organizing units ( CFU s ) of peculiar micro-organisms can take to life endangering infections particularly in the immune-compromised. Salmonella typhimurium is responsible for typhoid disease while Escherichia coli is a common cause of stomach flu. ( Becker et al 2008 ) . Other Enterobacteriaceae associated diseases include infirmary acquired pneumonia, blood stream infections such as bacteraemia and blood poisoning, urinary piece of land infections and intra abdominal infections ( Denton 2007 ) . Enterobacteriaceae have been preponderantly associated with nutrient pathogen eruption. As discussed by Reilly et Al ( 1988 ) 224 eruptions of salmonellosis associated with domestic fowl meat were reported in Scotland entirely between 1980 and 1985. Among the 2245 people infected 12 died. Salmonella typhimurium and Salmonella enteritis were the chief serotypes associated with the eruption. In recent old ages the serotype Enterobacter sakazakii now known as Cronobacter sakazakii been identified as an emerging pathogen. It has been found in infant milk expression and has been the cause of neonatal meningitis and sepsis. It targets immune-compromised babies and those with a low birth weight. ( Van Acker et al 2000 ) In the 1920 s coli-aerogenes ( coliform ) group was indispensable as an index in the proof of equal processing processs in the dairy industry i.e. Pasteurization of dairy merchandises. It is apparent that since the 1950 s the full Enterobacteriaceae household has been preferred over other taxons as marker beings as they are known to be better defined when it comes to their finding and the household includes more beings of significance than other households. In the 1980 s Escherichia coli was foremost used as a mention being in the monitoring of imbibing H2O supplies. ( Mossel and Stryijk 1995 ) A microbic index harmonizing to Moore and Griffith ( 2000 ) is a microorganism that is an index for the possible presence of pathogens. 1.2 Adherence of Enterobacteriaceae to surfaces. The adhesion of micro-organisms to surfaces in the nutrient industry chiefly on treating equipment is one of the major concerns in the equal control of quality and safety of nutrient merchandises. If cleansing and sanitation are deficient, micro-organisms on the surface can last by the development of a biofilm. ( Ortega et al 2009 ) . A biofilm reduces susceptibleness to disinfectant and increases polysaccharide production. The happening of a biofilm can take to post processing taint taking to a lowered shelf life of a merchandise and the transmittal of diseases. In add-on it has been known to do mechanical obstruction, damage of heat transportation, addition in unstable frictional opposition and the corrosion of metal. ( Fuster-Valls et al 2007 ) To day of the month no ideal method for finding the cleanliness of surfaces has been available. The combination of ocular, non microbial and microbiological methods can take to an integrated cleansing monitoring scheme. ( Griffith et al 1997 ) . The ability to quantify micro-organisms on nutrient contact surfaces provides indispensable information for patterning consumer exposure from cross taint in the nutrient industry through nutrient production, nutrient conveyance and in nutrient service environments. Many infective bacteriums have been known to adhere to surfaces particularly unstained steel, glass and gum elastic. Stainless steel is used extensively throughout the nutrient processing and the nutrient conveyance industry. As described by Ortega et Al ( 2009 ) , unstained steel is most widely employed due to its mechanical strength, corrosion opposition and easiness of fiction . Despite looking smooth to the unaided oculus, when chromium steel steel is viewed under the microsco pe it is shown to be really unsmooth with many distinguishable defects. These defects are thought to harbor bacterial cells which with the add-on of H2O and foods would heighten the micro-organism s endurance ( Moore and Griffith 2002 ) . There have been limited surveies on the adhesion behavior on Escherichia coli on chromium steel steel. Ortega et Al ( 2009 ) stated 108cfu/ml of civilization on chromium steel steel for 2 H at 20Â °C was under the sensing bound. In contrast another survey suggested 105cfu/cm2 were found on chromium steel steel after vouchers were inoculated with 108cfu/ml at 4 Â °C for 24 H. 1.3 Sampling of surfaces with swabs and sponges. Harmonizing to Hall and Hartnett ( 1964 ) , a simple convenient sample process would be utile to trace path of infection , for the identification of human bearers, rating of decontamination processs and bacteriological surveillance of the environment which could hence take to in-service preparation of forces concerned with sanitation . Surface sampling is going progressively of import and legion probes have been afoot to happen a simple, dependable, bacteriological trial to find, quantitatively, the healthful quality of environmental, nutrient and hand-contact surfaces. ( Angelotti et al 1958 ) . Cleaning agendas in the nutrient industry are designed chiefly to cut down both nutrient dust and to decrease microorganisms to degrees that pose small or low hazard to both safety and the quality of the merchandise. ( Moore and Griffith 2002 ) Traditional swabs are made from a wooden or plastic shaft with cotton, rayon, Dacron, or alginate fibers which are spun organizing a bud at one terminal. Moore and Griffith ( 2007 ) discourse how the wetting agents applied to swabs have dramatic effects on the sum of bacteriums recovered from a surface. The chief points to be assessed in finding how effectual peculiar swab types are depend on the remotion of bacterial contaminations from a surface, the release of these bacteriums from the swab bud and the subsequent cultivation . It was found that cotton swabs absorbed more liquid than other swabs evaluated. When bacteriums were recovered from wet surfaces it was apparent that coppice textured, Rayon and Dacron tipped swabs removed a significantly fewer CFU s compared to the cotton swabs. It was shown how cotton swabs performed every bit every bit good when trying a dry surface. Moore and Griffith ( 2007 ) province that cotton swabs consist of a secondary wall that is made up of cellulose. This enables the cotton to swell when positioned in wetness to ensue in an increased soaking up of liquid together with bacteriums entrapped indoors. These positive features that enable cotton swabs to take high degrees of bacteriums from a surface are thought to impede the swabs release of the bacterium. It can be predicted that the usage of a swab with a hapless initial absorbency could later ensue in a higher overall bacterial recovery with the assistance of dilutants to ease bacterial release. Moore and Griffith ( 2007 ) besides discuss how it was apparent upon go forthing the swabs at room temperature for 24 H that the release of bacteriums from the cotton swab was greater than other swabs. It was apparent that the bacterium became entrapped within the cotton fibres hence protecting the bacterium and assisting to make a microenvironment enabling the bacterium to last. In contrast to Moore and Griffith ( 2007 ) statements, Copan Italia ( 2010 ) shows how unfastened cell froth swabs have good release of the bacteriums but demonstrated soaking up of 3-5 times less than in traditional fiber swabs due to their construction ( Figure 1 ) . The development of Flocked swabs which have good releasing belongingss and can absorb five times more than cell froth swabs are widely used in clinical nosologies but have nt been applied yet to the recovery of Enterobacteriaceae throughout the nutrient industry. 1.4 Biochemical trials for the sensing and quantification of Enterobacteriaceae and their restrictions. Current biochemical and civilization based checks tend to be cheap and comparatively simple nevertheless there are restrictions with such trials. One of the chief restrictions includes the length of clip that is needed for the sensing and numbering of bacteriums. False- positive consequences, the loss of viability of bacteriums from aggregation to its numbering and the deficiency of growing of feasible yet non cultural bacteriums have been associated with current biochemical and civilization based checks. ( Rosrak and Colwell 1987 ) Today the Gram discoloration process is of common usage in research labs as the first method of designation for a micro-organism. The method was originally published in 1883 by Hans Christian Gram. This technique nevertheless is nt ever demonstrative of true Gram nature. Some Gram positive bacteriums may stain Gram negative due to cell wall harm in the bacteriums by over exposure to O. ( Bahrani Mougeot et al 2008 ) Blackburn ( day of the month? ) stated that the proving for enteral pathogens such as Salmonella requires specific methods that are labour intensive and can take several yearss to finish. Furthermore, infective bacteriums in nutrient are frequently non homogeneously distributed and are present in low Numberss doing sensing hard. Many nutrient production sites chiefly prefer to prove for enteral pathogens in external research labs while the testing of E.coli and Enterobacteriaceae are routinely tested to supply convenient appraisal of possible fecal taint. Many methods published from International Organisation for Standardisation ( ISO ) methods are available, where many processs of sensing are quantitative. The bulk of nutrient makers impose acceptable bounds for a given micro-organism. The Most Probable Number ( MPN ) technique from ISO 4831:2006 ( ISO 2010 ) and plating utilizing pour or spread technique are chiefly used. Violet Red Bile Glucose Agar ( VRBGA ) and Violet Red Bile Agar ( VRBA ) incorporating lactose have been deemed the most popular media for analyzing nutrients for Enterobacteriaceae. Their sensing and numbering are based chiefly on their ability to bring forth acid and gas from the agitation of glucose and milk sugar which is detected by the pH index impersonal ruddy. An sheathing is recommended to guarantee agitation of the saccharides and to cut down the hazard of oxidization every bit good as bettering the specificity of these media and later cut downing intervention from background vegetations or motile strains ( Blackburn day of the month? ) . There has been grounds that non Enterobacteriaceae bacteriums can turn on VRBA and VRBGA hence proposing that this method can impede specificity. The growing of Aeromonas spp has been detected on VRBGA harmonizing to Petzel and Hartman ( 1985 ) and VRBGA has been seen to be insufficiently selective bespeaking 52.4 % of consequences obtaine d to be false- positive ( Wook Oh and Kang 2004 ) MPN methods can supply greater sensitiveness compared with plating techniques when the taint degrees are low. However if the concentration of taint is high the consequences show greater fluctuation and may take to false positive consequences. MPN technique consists of multiple tubings of different media including Buffer Peptone H2O, Enterobacteriaceae enrichment stock. ( See figure 2 ) Enterobacteriaceae are oxidase negative and this trial is used to prove for the presence of the enzyme cytochrome oxidase to corroborate presumptive settlements in correlativity with glucose agar trial which tests for agitation of glucose. If agitation occurs it consequences in abundant production of acerb terminal merchandises ensuing in a color alteration. This method required by ISO described by Rose et Al ( 1974 ) has low preciseness and inordinate clip is necessary for analysis runing from 5-7 yearss. APIa„? designation systems from Biomerieux are used widely throughout research labs. ID32E, is a standardized system in which the designation of Enterobacteriaceae and other not fastidious Gram negative bacteriums can be quickly identified. Many surveies have been reported utilizing API as method of designation including those of Drudy et Al ( 2006 ) and Galani et Al ( 2007 ) . The API/ID32E sensing kit is the most extended of the scope of API merchandises available. It includes 15 designation systems covering all groups of bacteriums encountered in industrial microbiological research labs ( BioMerieux, 2010 ) . The dependability of APIa„? designation systems it used throughout industries. Janda et Al ( 2001 ) stated nevertheless that the trials included in the API 20E strip in 1975 were still the same in 2001 even if the Numberss of taxons in the Enterobacteriaceae household has increased well between those old ages. The ready to utilize Petrifilm system has been released by 3M health care for the sensing of foodborne pathogens. It s easy to utilize technique comprises a selective media under a transparent movie ( 3M health care ) . The media is hydrated by the add-on of bacterial suspension and after incubation seeable settlements can be counted. ( Blackburn? ? ) Despite this method being speedy and convenient, Petrifilm systems are expensive. Restrictions of this technique discussed by Mueller et Al ( 2009 ) show that some settlements shown on Petrifilm are excessively little to see from bare oculus. Therefore the usage of magnification for accurate visual image is required. It was shown that some beings can liquefy the gel on the movie leting spreading of growing and subsequent harm to other bing settlements supplying a lower count of settlements. Standard methods such as conventional civilization and biochemical based checks used to recite necessitate 18-24 H for consequences to be obtained. Progresss in modern molecular biological science have seen the development of molecular checks such as the polymerase concatenation reaction ( PCR ) that have become highly dependable and important in the sensing of bacterial species ( Khan et al 2007 ) . 1.5 Alternate DNA- based method for the sensing and quantification of Enterobacteriaceae 1.51 DNA extraction The rules of DNA extraction as discussed by Jordan ( 2008 ) include the debasement of microbic cell wall to let go of the Deoxyribonucleic acid and to sufficiently take sample constituents which can cut down assay efficiency and degrade the Deoxyribonucleic acid. Due to the complexness of nutrients matrices there are many inhibitors of DNA extraction including saccharides, fats, proteins, metal ions, phenoplasts and cell dust. 1.52 Polymerase Chain Reaction Polymerase Chain Reaction ( PCR ) is one of the most widely used molecular biological science techniques in the research lab. This is due to its specificity, flexibleness, singular velocity and its resiliency ( Mc Pherson et Al 1995 ) . PCR was developed in the 1980 s and the technique has been continuously improved and modified to spread out its versatility and pertinence . This Deoxyribonucleic acid based method has become an indispensable and day-to-day performed experimental technique in many research Fieldss and clinical research labs to observe infective agents, to magnify familial stuffs from limited volumes of DNA sample ( AÂ µl ) and for cloning for sensing of familial look degrees. ( Yang et al 2005 ) . PCR is utile for both the diagnosing and direction of a assortment of infective diseases. ( Louis et al. , 2000 ) PCR Mix: PCR mix is made up of DNA polymerase, a forward and a contrary primer, bases, a DNA Target and PCR buffer with MgCl2. PCR stairss PCR elaboration can turn a few molecules of a specific mark nucleic acid into a mcg of DNA. Roche PCR Applications Manual ( 2006 ) explained how the procedure of PCR occurs in three chief stairss of 1 ) Denaturation, 2 ) Annealing and 3 ) Extension with the usage of temperature cycling ( figure 3 ) . Denaturation occurs at 90Â °C when heat separates double stranded DNA into two individual strands. Since the H bonds associating the bases to one another are weak they break at such high temperatures, whereas the bonds between the deoxyribose and phosphates which are strong covalent bonds remain integral. The end of PCR procedure is non to retroflex the full strand of Deoxyribonucleic acid but to retroflex a mark sequence of about 100-35,000 base brace that is alone to the being. Primers are used to specify the terminals of that sequence. Primers are short, man-made sequences of single- stranded DNA typically dwelling of 20-30 bases. The annealing measure takes topographic point between 40Â °C to 65Â °C depending on the length on the length and sequence of the primers. This allows the primers to temper specifically to the mark sequence. Once the primers anneal to the complementary DNA sequences, the temperature is raised to about 72Â °C and DNA polymerase begins to synthesise new dual stranded Deoxyribonucleic acid molecules that are indistinguishable to the original mark DNA. It does this by easing the binding and connection of complementary bases that are free in solution ( dNTPs ) . Synthesis ever begins at the 3 terminal of the primer and returns entirely in the 5 to 3 way. The new synthesis efficaciously extends the primers, making a complementary two-base hit stranded molecule from a single-stranded templet. After the PCR procedure is complete, cataphoresis must be completed in order to For the sensing of bacteriums within nutrients the mechanism of PCR has proved to be really effectual. Low degrees of 3cells of Campylobacter were found in meat samples utilizing this technique ( Waage et al 1999 ) . However During PCR elaboration, short Deoxyribonucleic acid sequences are copied at each rhythm. Theoretically the sum of Deoxyribonucleic acid at each rhythm should duplicate at each rhythm, ensuing in an exponential elaboration of the initial mark DNA. Fraga et Al ( 2009 ) demo how this is potentially true during the early phases of the reaction when the constituents present in PCR are in huge extra compared to the mark sequence. As the merchandise accumulates, the substrates become low ensuing in suppression. In order to look at the efficiency of the reaction, PCR can be divided into three distinguishable stages: exponential, additive and tableland. The first stage is exponential stage in which the reaction is 100 % efficient with the doubling of merchandise at each rhythm. As the amplicon exponentially accumulates in measure the PCR constituents are used up and the primers begin to vie with the amplicon and the reaction efficiency later decreases. As the reaction slows down the additive stage begins. The merchandise formed in this stage is extremely variable due to the rate at which peculiar constituents are depleted and the accretion of merchandises. The tableland stage is when the reaction Michigans due to depletion of substrates and the suppression of merchandises. There is an highly big difference between the additive stage and the concluding sum of merchandise produced. In conventional PCR, sensing of PCR merchandise is completed late in the additive stage or at plateau stage. As seen in figure 5 there can be a distinguishable difference in the two stages demoing that conventional PCR is variable when it comes to quantitative consequences. 1.42 Real clip PCR The development of existent clip quantitative PCR ( QPCR ) presents more rapid, specific and quantitative numbering of peculiar mark cistrons as they are amplified in existent clip. In existent clip PCR the sum of merchandise formed is monitored during the class of the reaction by supervising the fluorescence of dyes or investigations introduced into the reaction that is relative to the sum of merchandise formed, and the figure of elaboration rhythms required to obtain a peculiar sum of DNA molecules is registered. ( Kubista et al 2006 ) . Real clip PCR checks are characterized by a broad scope of quantification of 7-8 logarithmic decennaries, high proficient sensitiveness, high preciseness and it does nt necessitate any station PCR steps hence the hazard of taint is reduced. ( Klein D 2002 ) Real clip PCR processs follow the same rules of conventional PCR in the readying of mixes and cycling of temperature. This rapid sensing method uses a sensing format, normally a fluorescent dye that binds to the PCR merchandise. The sum of fluorescence generated is relative to the sum of PCR merchandise formed. Initially the signal is weak and hence indistinguishable from the background but as the PCR merchandise accumulates, the fluorescence can be acquired by the existent clip PCR device. A threshold line is developed by the existent clip device and the CT value is determined. CT value is the figure of rhythms required to make fluorescent threshold. Real clip PCR generates a CT value for each DNA sample which is hence relative to the transcript figure DNA. Normally used fluorescent Reporters SYBR Green 1. Asymmetric cyanine dyes such as SYBR Green 1 have two aromatic systems incorporating N, one that is positively charged connected by a methine span. The dye has virtually no fluorescence when free in solution due to quivers prosecuting both aromatic systems, which convert electronic excitement energy into heat that dissipates to the environing dissolver. When the dyes bind with DNA they emit fluorescence. ( Nygren et al 1998 ) As disussed by LightCycler Rea clip PCR Systems ( 2009 ) , SYBR Green binds to all double stranded Deoxyribonucleic acid molecules irrespective of the sequence. When it comes into contact with dual stranded Deoxyribonucleic acid its fluorescence additions significantly. Harmonizing to Monis et Al ( 2005 ) SBYR Green 1 has a restriction in dye stableness and dye dependent PCR suppression and the selective sensing of amplicons during DNA runing curve analysis. HYBRIDISATION PROBES HYDROLYSIS PROBES TAQMAN PROBES LUX PRIMERS SYBR Green 1 is normally used in existent clip PCR. However, these asymmetric dyes nevertheless are considered sequence non-specific newsmans in real-time PCR. They tend to breathe fluorescence signal to all double stranded DNA even unwanted primer-dimer merchandises. Primer dimer merchandises interfere with the formation of specific merchandises due to competition of the two reagents and may take to wrong readings. Melting curve analysis can easy recognize primer-dimer formation. Temperature is increased and fluorescence is measured as a map of temperature. As temperature additions, fluorescence lessenings due to increased thermic gesture. When dual stranded DNA separates an disconnected bead in the fluorescent signal occurs. Since primer-dimers are shorter and they tend to run at a lower temperature, they are easy recognised in runing curve analysis. Light Upon Extension ( LUX primer ) : based on oligonucleotides labelled with a individual fluorophore. They do non necessitate a quencher mediety includes a single-labeled primer with a FAM fluorophore at the 3 terminal in a hairpin construction and a corresponding unlabelled primer, designed to amply the 5 terminal of the cistron encoding the S protein ofTGEV. The constellation of the labelled primer enables the fluorescence slaking capableness. When the primer is incorporated into double-stranded RT-PCR merchandise, the fluorophore is dequenched, ensuing in a important addition in fluorescent signal Unlike the current good known real-time engineering that relies on a man-made DNA investigation labeled with two different fluorescent dyes, LUX primers engineering does non necessitate an expensive investigation so is more suited for everyday research lab diagnosing. What a LUX check demands is a specific primer set with a individual labeled, self-quenched primer and a corresponding unlabelled one, it is more dependable than the real-time method usingDNA bindingdyes that may bring forth potentially deceptive consequences due to the deficiency of specificity of the dyes. A old survey besides indicates that the LUX primers engineering is dependable for quantitation of cistron look and the consequence is similar to the probe-based quantitative check ( Brian et al. , 2003 ) . LUX fluorogenic primers can be designed and ordered via online package. The LUX check besides has the advantage of addition velocity and is less arduous over the gel-based RT-PCR technique that is presently the everyday cistron analysis tool forTGEV. The LUX assay took less than an hr to finish the elaboration reaction and the procedure was viewed in existent clip, while conventional RT-PCR methods normally take more than 1h for cistron elaboration and half an hr or more to run the gel and analyze the consequence. The advantage of velocity of the LUX check is more evident when compared to other everyday diagnostic methods for TGE Furthermore, the LUX check is closed-tube and one-step technique, which reduces the hazard of taint and reaction variableness. This sensitive and specific trial complements bing cistron methods for the sensing ofTGEV. The method shall turn out to be a valuable tool in the research lab diagnosing ofTGEV, particularly as a agency of corroborating positive consequences from serological trials. LUX primers engineering supports manifold elaboration ( hypertext transfer protocol: //www.invitrogen.com/lux ) that makes observing different pathogens in a individual check possible. By utilizing two sets of primers, each labeled with a different dye, a individual LUX check can observe two different viruses. LUX primers are compatible with a broad assortment of real-time PCR instruments ( hypertext transfer protocol: //www.invitrogen.com/lux ) . More checks can be developed for the sensing of other pathogens. By cut downing the cost of real-time cistron sensing and with high public presentation, LUX fluorogenic primers engineering may has the possible to be used widely in the field ofanimal diseasesurveillance and control every bit good as import and export carnal quarantine direction. Advantages of utilizing DNA for microbic Testing Deoxyribonucleic acid is stable and unswayed by environmental factors while being independent from bacterial fundamental law doing consequences conclusive non subjective. It is accurate due to species specific mark sequence which is unattainable with cultural methods and public presentation controls can be added. There are good established DNA sensing methods available which enable fast sensing. Reliable industry of primers and investigations. 2.1 Preparation of Deoxyribonucleic acid from bacterial strains The undermentioned Enterobacteriaceae strains were obtained ( MicroBioLogics Inc, Minnesota, USA ) Escherichiacoli ( ATCC 11775 ) , Serratiamarcescens ( ATCC 13880 ) , Enterobacteraerogenes ( ATCC 13048 ) , Salmonella typhimurium ( ATCC 13311 ) Erwinia persicina ( ATCC 1381 ) Shigella flexneri ( ATCC 9199 ) Klebsiella pneumonia ( ATCC 700603 ) , Yersinia enterocolitica ( ATCC 9610 ) Listeria monocytogenes ( ATCC 19115 ) , Vibrio parahaemoliticus ( ATCC 17802 ) , Aeromonas hydrophila ( ATCC 7966 ) and Campylobacter jejuni ( ATCC 29428 ) . The University of Limerick supplied the strains Cronobacter sakazakii, Enterobacter cloacae, Pseudomonas aeruginosa and Proteus Mirabilis. The National Collection of Type Cultures ( Health Protection Agency Culture Collections, Salisbury, UK ) supplied Staphylococcus aureus ( NCTC 8325 ) . All strains of bacteriums were stored on Protect beads 109 ( LangenBach services Ltd, Dublin, Ireland ) at -20Â °C until cultivation. All Enterobacteriaceae strai ns grown on alimentary agar ( NA ) ( Oxoid, Basingstoke, UK ) at 37Â °C for 24hr AÂ ± 2 hour except Erwinia persicina which was grown at 30Â °C, Listeria monocytogenes and Staphylococcus aureus grown at 37Â °C. Vibrio parahaemoliticus grown at 35Â °C on Trypic soybean agar ( TSA ) ( Oxoid ) Confirmation and Identification of the mention micro-organism E coli. The designation of Escherichia coli ( ATCC 11755 ) was verified by the undermentioned biochemical trials. The Gram discoloration process was applied to a settlement from the fresh civilization on NA. Oxidase trial was carried out utilizing oxidase strips ( bioTRADING, Dublin, Ireland ) . A positive control of Pseudomonas aeruginosa and a negative control of Staphylococcus aureus were used to corroborate the dependability of the trial. API designation utilizing ID 32E was carried out harmonizing to maker s instructions ( BioMerieuxAÂ ®S.A, Craponne, France ) and identified utilizing the package Apiweb ( BioMerieux ) 2.2 Preparation of bacterial suspension. Pre-cultures were prepared by infixing a loop full of bacterial settlement into Nutrient Broth ( Oxoid ) with incubation of 37Â °C for all Enterobacteriaceae with the exclusion of Erwinia persicina which was grown at 30Â °C, Listeria monocytogenes and Staphylococcus aureus grown at 37Â °C. A loop full of Vibrio parahaemolyticus was grown at 35Â °C on Tryptic Soya Broth ( TSB ) ( Oxoid ) In peculiar the growing of Escherichia coli in alimentary stock was studied by mensurating the optical denseness and home base numeration. Spectrophotometric measurings were obtained at 600nm utilizing ( insert name here ) .Optical denseness was acquired every 30min from 0min to 4h 30min 2.3 Usual spiking of vouchers and recovery by swobing. Stainless steel vouchers of class 304 were obtained. Regions to be spiked with Escherichia coli were indicated utilizing a templet ( ) ( 10cm x 10cm ) . Each voucher was spiked by pipetting 100AÂ µl of Escherichia coli civilization onto the surface and utilizing a spreader ( ) . After allocated clip ( 0min 30min or 60min ) , vouchers were swabbed utilizing cotton swab. Each voucher was swabbed twice: horizontally and vertically. Each swab was cut and placed into the interior tubing of swab extraction tubing system ( SETS ) ( Roche Diagnostics, Mannheim, Germany ) .Each aggregation tubing was later centrifuged at 10000g for 10min ( Sigma1-15 ) . Then the inner tubings and the supernatants were discarded. Pellets were re-suspended in 250AÂ µl Ringer one-fourth strength solution ( Oxoid ) . Dilution series in one-fourth strength toller solution were prepared, plated out on alimentary agar and incubated 18-24h at 37Â °C. 2.4 Study of the release of Bacteria from different swabs and sponges. Comparative survey of the recovery of Escherichia coli cells was performed utilizing cotton, rayon and alginate swabs. ( Copan Italia S.p.A, Brescia, Italy ) . 100AÂ µl of 18h Escherichia coli civilization were deposited straight onto each swab. Swabs were cut and placed into SETS tubes. Tubes were centrifuged at 10000 g for 10 min. Pellets were re-suspended with 200AÂ µl of quarter-strength Ringer Solution ( Oxoid ) . Dilution series were made and 100 AÂ µl of diluted sample were plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37Â °C for 24 H. Large sponges ( Medical Supply Co Ltd, Dublin, Ireland ) were tested to retrieve bacteriums from surfaces by swobing after allocated clip ( 0 min, 30 min, 60 min ) . Each sponge impregnated with 10ml Maximal Recovery Diluent ( MRD ) ( Oxoid ) was inserted into a stomacher bag ( ) supplemented with 100ml of MRD and stomached utilizing stomacher ( ) for 120 s at high power. Dilution series were made and 100AÂ µl of diluted sample was plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37Â °C for 24 H 2.5 Detection and Quantification of feasible bacteriums from surfaces. Plate numeration expression was obtained as per ISO 4833:1991 ( Harrigan W.F 1998 ) which has since been renewed to ISO 4833:2003 Microbiology of nutrient and animate being eating materials Horizontal method for the numbering of micro-organisms Colony-count technique . The home base numeration expression was? c/ ( n1 + 0.1 n2 ) vitamin D where? degree Celsius was the amount of all settlements counted on all dishes, n1 was the figure of dishes in 1st dilution, n2 was figure of dishes in 2nd dilution and vitamin D represented the dilution. Miles and Misra method as per Harrigan W.F ( 1998 ) was used in peculiar when proving recovery of Escherichia coli from the big sponges. 2.10 Bacterial designation of bacteriums in the suspension used to make the unreal nutrient environment on surfaces. The suspension was prepared from 34 swabs samples that were collected from nutrient contact surfaces in Dawn Fresh Food Company, Fethard, Co. Tipperary. Each swab was assorted with 0.1 % peptone H2O ( Oxoid ) and the suspension were pooled together to make one chief suspension that was assorted with half volume glycerol 50 % ( Sigma Aldricha„? Inc ) . This suspension was aliquoted into 1ml eppendorf tubings and maintain in at -80Â °C. A entire feasible count was determined by utilizing the Miles and Misra method and later by home base numeration following a dilution series of bacterial suspension. The sensing of Listeria monocytogenes, Staphylococcus aureus and the Enterobacteriaceae were targeted. In the instance of Listeria monocytogenes 1ml of sample was dispensed into 9ml Buffer Peptone H2O ( Oxoid ) . Incubate 37Â °C for 18-24hours. After 24 H transportation 10ml from tubing into 90ml of Listeria Enrichment stock ( Oxoid ) , incubate for 48 H at 30Â °C guaranting agitation. After 48 h a loop full of solution was streaked on a Listeria agar home base ( Oxoid ) and incubated for 48 H at 30Â °C. Listeria Petrifilm ( 3Ma„? , Dublin, Ireland ) was used following maker s instructions. For the designation of Staphylococcus 100AÂ µl of unreal nutrient environment was plated on baird Parker agar ( Oxoid ) administering the organic burden throughout the home base utilizing a spreader and incubated at 37Â °C for 48 h. After 48 h agglomeration was tested utilizing PastorexAÂ ® Staph Plus trial. ( Biorad ) . Catalase activity was tested by the add-on of H2O2 ( ) . Each suspected Staphylococcus aureus settlement was placed in 1ml of toller solution that was later pipetted on to Staph Petri movie ( 3Ma„? ) . Petri movie was placed in brooder for 24 H at 37 Â °C. Enterobacteriaceae was detected utilizing most likely figure ( MPN ) See appendix. 2.6 DNA extraction: For specificity for PCR checks, bacterial pellets were obtained antecedently from civilizations in exponential growing stage were used with the exclusion of Camplyobacter jejuni. One settlement of C.jejuni was resuspended in 0.1 % Peptone H2O ( Oxoid ) and centrifuged at 5000 g for 5 min. For the quantification of bacteriums from surfaces, pellets were recovered from SETS after centrifugation of 1ml of civilization at 5000 g for 5 min. A rapid purification of DNA samples utilizing DNeasy Blood and Tissue Kit ( Qiagen, West Sussex, UK ) was preformed following maker s instructions. Deoxyribonucleic acid was extracted, purified and later quantified utilizing Nanodrop ND 1000 spectrophotometer ( ThermoScentific, Wilmington, USA ) Deoxyribonucleic acid concentrations were adjusted to 1ng per 2AÂ µl 2.7 Choice of Primer sets. 2.7-1 ENT Primers ENT primers developed by Nakano et Al ( 2003 ) and designed to temper to the 16S rRNA cistron of Escherichia coli. The sequence of the forward primer: 5GTTGTAAAGCACTTTCAGTGGTGAGGAAGG 3was 425 through 454 in the E. coli 16S rDNA while the sequence of the contrary primer 5GCCTCAAGGGCACAACCTCCAAG 3 had places 826 through 848 in the E.coli 16S rDNA. ENT primers expected to take to formation of 419-425 bp of PCR merchandise. 2.7-2 IEC primers: IEC primers as described by Khan et Al ( 2007 ) are oligonucleotide primer braces derived from the distal and proximal conserved flanking parts of the16S rRNA cistron, the Internal Transcribed Spacer ( ITS ) part and the 23S rRNA.IEC frontward primer 5CAATTTTCGTGTCCCCTTCG 3 and change by reversal primer 5GTTAATGATAGTGTGTGTCGAAAC 3 had expected PCR merchandise length of 450bp. 2.8 PCR Conditionss For a individual PCR 25 AÂ µl PCR reaction, PCR maestro mixes were prepared with unfertile DNA H2O, PCR buffer 2mM MgCl2, 25mM MgCl2, a dNTP mixture ( dATP, dTTP, dCTP, dGTP ) , frontward primer, change by reversal primer, DNA polymerase and 2AÂ µl of peculiar DNA. PCR was carried out on G-STORM GS2 Thermal Cycler. ( Familial Research Instrumental Ltd, Braintree, UK ) . The elaboration conditions were as follow: stopping point palpebra and heated to 111Â °C, 95Â °C for 6 min, bacterial rhythm start of 28ycles, denaturation measure of 95AÂ °C for 30 s, tempering temp between gradient of 56-62AÂ °C depending on primer type for 15 s, elongation for 30 s at 72Â °C. End rhythm with elongation for farther 7 min at 72Â °C. Cycle was repeated 30 times. 2 % Agarose gel ( Biosciences, Dun Laoghaire, Ireland ) pre-stained with SYBR Safea„? ( Molecular Probes, Eugene, USA ) cataphoresis was run in Tris ethanoate EDTA ( TAE ) . ( Sigma Aldricha„? Inc, Saint Louis, USA ) with Amplisize ( Biorad, Hercules, USA ) as a molecular marker runing from 50 to 2000 bp. The gel was examined in G-BOX ( Syngenes, Cambridge, UK ) under UV visible radiation. Recovery of E coli in the presence of an unreal nutrient environment Innoculum was prepared with pre-culture at the exponential stage when the concentration was 108cfu/ml. 100AÂ µl was pipetted onto chromium steel steel vouchers incorporating different concentrations of unreal nutrient environment ( high, medium or low concentrations ) . After allocated clip ( 0 min, 30 min, 60 min ) vouchers were swabbed at 90Â °angle. Swabs were cut into SETS ( Roche Applied Science ) and centrifuged for 10 min at 6000g. Pellet was re-suspended with 150AÂ µl toller solution leting 50AÂ µl for EMA intervention and 50AÂ µl for home base numeration. Preparation of Propidium monoazide ( PMA ) PMA dissolved in 20 % DMSO to obtain a stock concentration of 20nM and stored at -20Â °C off from the visible radiation. 1.25AÂ µl PMA solution added to 500AÂ µl of civilization aliquots to give a concluding concentration of 50nM following the incubation period of 5minutes in the dark with occasional commixture to let the PMA to perforate the dead cells and to adhere to the DNA. Samples are so put in ice and placed 20cm from 500W halogen visible radiation beginning for 15minutes. Samples centrifuged at 10,000g for 10 proceedingss. Samples washed with NaCl ( ) and MilliQ H2O ( ) in order to take the inactivated PMA. Bibliography. Angelotti R, Foter M.J, Busch K.A, Lewis K.H ( 1958 ) . A comparative rating of methods for finding the bacterial taint on surfaces Public Health Report 79 ( 11 ) pp 1021-1024 available: PubMed database [ accessed 10 March 2010 ] Astrographics ( 2002 ) Escherichia coli bacteria [ image online ] , available: hypertext transfer protocol: //www.astrographics.com/GalleryPrintsIndex/GP2144.html [ assessed 10 March ] Becker, B. , Weiss, C. , Holzapfel, W.H ( 2008 ) An rating of the usage of three phenotypic trial systems for biochemical designation of Enterobacteriacea and Pseudomonadacea Food Control 20 ( 9 ) available: Science Direct [ accessed 13 Feb 2010 ] Bej, A.K. , Steffan, R.J. , DiCesare, J. , Haff, L. , Atlas, R.M. , ( 1990 ) Detection of coliform bacteriums in H2O by polymerase concatenation reaction and cistron investigations. Applied Environment Microbiology 56 pp 307-314 Biomerieux Industry ( 2010 ) APIAÂ ®ID32E [ online ] available: hypertext transfer protocol: //www.biomerieux-industry.com/servlet/srt/bio/industry-microbiology/dynPage? open=NDY_IND_FDA_PRD A ; doc=NDY_FDA_PRD_G_PRD_NDY_17 A ; pubparams.sform=0 A ; lang=en [ accessed 19 March 2010 ] Bahrani- Mougeot F.K. , Paster, B.J. , Coleman, S. , Ashar, J. , Knost, S. , Sautter, R.L and Lockhart, P.B ( 2008 ) Designation of unwritten bacteriums in blood civilizations by conventional versus molecular methods Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and Endodontology 105 ( 6 ) pp 720-724. Available: Science Direct [ accessed 11 March 2010 ] Copan Italia ( 2010 ) Why flocked swabs are superior to fibre cloaked swabs and froth swabs and how they can better infective disease nosologies , [ online ] , available: hypertext transfer protocol: //www.mls.be/nieuwsbrieven/css/Why-Flocked-Swabs-are-Superior-to-Fiber-and-Foam.pdf [ accessed 30 Feb 2010 ] Denton, M ( 2007 ) Enterobacteriaceae International Journal of Antimicrobial Agents 29 ( 3 ) available: Science Direct [ accessed 24 Feb 2010 ] Drudy D, O Rourke M, Murphy M, Mullane N.R, Kelly L, Fischer M, Sanjaq S, Wall P, OMahony M, Whyte P, Fanning S ( 2006 ) Characterisation of a aggregation of Enterbacter sakazakii isolates from environmental and nutrient beginnings International Journal of Food Microbiology 110 ( 2 ) pp 127-134 available: Science Direct database [ accessed 18 March 2010 ] Food Market Exchange ( 2001 ) HACCP Hazard Analysis Critical Control Point [ online ] available: hypertext transfer protocol: //www.foodmarketexchange.com/datacenter/laws/detail/dc_lr_reference_haccp [ accessed 17 Feb 2010 ] Galani I, Rekatsina P.D, Hatzaki D, Plachouras D, Souli M, Giamarellou H ( 2007 ) Evaluation of different research lab trials for the sensing of metalo-?-lactamase production in Enterobacteriaeae , Journal of Antimicrobial Chemotherapy 61 pp 548-553 Grant, M.A. , Weagent, S.D. , Feng, P ( 2001 ) Glutamate decarboxylase cistrons as a pre-screening marker for sensing of Escherichia coli groups Applied Environment Microbiology 67 pp 3110-3114 Griffith C.J, Davidson C.A, Peters, A.C and Fielding, L.M ( 1997 ) Towards a strategic cleansing assessment programme: hygiene monitoring and ATP luminometry, an options assessment Food Science Technology Today 11, pp 15-24. Hall L.B and Hartnett M.J ( 1964 ) Measurement of bacterial taint on surfaces in infirmaries Public Health Report 79 ( 11 ) pp 1021-1024, available: PubMed database [ accessed 24 March 2010 ] Horachova, K. , Mlejnkova, H. , Menjnek, P. , ( 2006 ) Direct sensing of bacterial fecal indexs in H2O samples utilizing PCR Water Science Technology 54 pp 135-140 Huang M.M, Arnheim N, Goodman M.F ( 1992 ) Extension of base mispairs byTaqDNApolymerase: deductions for individual nucleotide favoritism in PCR Nucleic Acids Research 20 ( 17 ) pp 4567-4573 Iqbal, S. , Robinson, J. , Deer, D. , Saunders, J.R. , Edwards, C. , Porter, J. , ( 1997 ) , Efficiency of the polymerase concatenation reaction elaboration of the uid cistron for sensing of Escherichia coli in contaminated H2O Lett Applied Microbiology 24 pp 498-502 Janda, J.M and Abbott, S.L ( 2001 ) Bacterial Designation for Publication: When is Enough, Enough? Journal of Clinical Microbiology 40 ( 6 ) pp 1887- 1891 Juck, D. , Ingram, J. , Prevost, M. , Coallier, J. , Greer, C ( 1996 ) Nested PCR protocol for the rapid sensing of Escherichia coli in drinkable H2O , Canadian Journal of Microbiology 42 862-866 Kang D, Eifert J.D, Williams R.C ( 2007 ) Evaluation of Quantitative Recovery Methods of Listeria monocytogenes Applied to Stainless Steel Journal of AOAC International 90 ( 3 ) Kenyon College ( 2010 ) , PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Kenyon College ( 2010 ) PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Khan, I.U.H. , Gannon, V. , Kent, R. , Koning, W. , Lapen, D.R. , Miller, J. , Neumann, N. , Phillips, R. , Robertson, W. , Topp, E. , Bochove, E. , Edge, T.A ( 2007 ) Development of rapid quantitative PCR check for direct sensing and quantification of culturable and non- culturable Escherichia coli from agiculture water partings Journal of Microbial Methods 67 pp 480-488 available: Science Direct [ assessed 13 March 2010 ] Kubista, M. , Andrade, J.M. , Bengtsson, M. , Forootan, A. , Jonak, J. , Lind, K. , Sindelka, R. , Sjoback, R. , Sjogreen, B. , Strombom, L. , Stahlerg, A. , Zoric, N. , ( 2006 ) The existent clip polymerase concatenation reaction Molecular Aspects of Medicine 27 pp95-125 available: Science Direct [ accessed 11 March 2010 ] .REVIEW Louie, M. , Louie, L and Simor, A. , E. ( 2000 ) . The function of DNA elaboration engineering in the diagnosing of infective diseases Canadian Medical Association Journal 163 ( 3 ) , pp 301-305 Mc Pherson, M. J. , Hames B. D, and Taylor, G. , R. , ( 1995 ) , PCR 2: A Practical Approach Oxford University Press, New York Microbiological hazard appraisal series 10 ( 2006 ) Enterobacter sakazakii and Salmonella in powdery baby expression, Google Books [ online ] , available: hypertext transfer protocol: //books.google.com/books? id=iHZSx2Wfe7EC A ; pg=PA76 A ; dq=enterobacteriaceae+in+food A ; as_brr=1 A ; cd=1 # v=onepage A ; q=enterobacteriaceae % 20in % 20food A ; f=false [ assessed 9 March 2010 ] Mossel D.A, Stryijk C.B ( 1995 ) Escherichia coli, other Enterobacteriaceae and extra indexs as markers of microbiologic quality of nutrient: advantages and disadvantages , Microbiologica 11 ( 1 ) pp 75-90. Available: Medline [ accessed 24 Feb 2010 ] Moore and Griffith ( 2002 ) Factors act uponing recovery of micro-organisms from surfaces by the usage of traditional hygiene swobing , Dairy, Food and Environmental Sanitation 22 ( 6 ) pp 410-421 Mueller, S.A. , Anderson, J.E and Byung, K ( 2009 ) Comparison of Plate counts, Petrifilm, Dipslides and Adenosine Triphosphate Bioluminescence for supervising bacteriums in chilling H2O armored combat vehicles , Water Environmental Research 81 ( 4 ) available: Wilson web [ accessed 24 March 2010 ] Nygren, J. , Svanvik, N. , Kubista, M. , ( 1998 ) The interaction between the fluorescent dye thiazole orange and DNA Biopolymers 46 pp 39-51 Ortega, M.P. , Hagiwara, T. , Watanabe, H. , Sakiyama, T. ( 2009 ) Adhesion behavior and removability of Escherichia coli on chromium steel steel surface Food Control 21 ( 4 ) pp 573-578 available: Science Direct [ accessed 13 March 2010 ] Reilly W.J. , Forbes, G.I. , Sharp, J.C.M. , Oboegbulem, S.I. , Collier, P.W and Paterson, G.M ( 1988 ) Poultry- Borne Salmonellosis in Scotland , Epidermiology and Infection 101 ( 1 ) pp 115-122 Rose, R.E. , Geldreich, E and Litsky, W ( 1974 ) Improved membrane filter method for fecal coliform analysis , Applied Microbiology 70 ( 9 ) pp 5692 5694. Roche PCR Applications Manual ( 2006 ) 3rd ed. , Germany: Fanz and Neumayer Rosrak D.B, Colwell R.R ( 1987 ) Survival schemes of bacteriums in the natural environment Microbial Rev 51 pp 365-379. Tsen, H.Y. , Lin, C.K. , Chi, W.R. , ( 1998 ) Development and usage of 16S rRNA cistron targeted PCR primers for the designation of Escherichia coli cells in H2O Journal of Applied Microbiology 85 pp 554- 560 Van Acker, J. , De Smet, I. , Muyldermans, G. , Bougatef, A. , Naessens, A. , Lauwer, S. ( 2000 ) Outbreak of Necrotizing Enterocolitis Associated with Enterobacter sakazakii in Powered Milk Formula , Journal of Clinical Microbiology 39 ( 1 ) pp 293-297 Wook Oh, S and Kang, D.H ( 2004 ) , Fluorogenic selective and differential medium for isolation of Enterobacter sakazakii , Applied and Environmental Microbiology, 70 ( 9 ) pp 5692-5694. Yang I, Kim Y H, Byun J.Y, Park S.R ( 2005 ) Use of manifold polymerase concatenation reactions to bespeak the truth of theannealing temperature of thermic cycling Analytic Biochemistry 338 ( 2 ) available: Science Direct [ assessed 10 March 2010 ]

Syndicated Loans And Bonds Essay Example | Topics and Well Written Essays - 1000 words

Syndicated Loans And Bonds - Essay Example To gain a clear perspective of what a syndicated loan facility, let us first understand the nature thereof. Syndication can be loosely translated in terms of pooling of resources and capital. Banks are syndicated when they come together to carry out a single or multiple business transactions to a single or multiple individuals. One of the most popular transactions which these syndicated banks undertake is the syndicated loan facility. A syndicated loan facility is the term, which refers to a long-term loan, issued by a number of banks collectively to a single client or borrower. A lead institution or bank will serve as the secretariat and manage the syndicate. Typically, not all banks that will respond to the call for syndication have the same financial capacity and standing, they may not be on equal footing at all. Thus, the need for a system that will allow the participating banks to limit their participation according to their capacity in order to mitigate any incidents that may potentially lead to overexposure1. In other words, participating banks maintain their own independent operati ons and the participating banks only maintain â€Å"an arm’s length relationship†2 with each other. By contrast, bonds are securities issued by companies to the public as evidence of indebtedness. Bonds are promises to pay the principal as well as interest to its holder at a certain specified time indicated in the instrument. Government and business corporations for a number of purposes, which are generally indicated on the face of the certificates, may issue it. Generally, issuance of bonds is another form of borrowing money. Thus, the relationship formed between the issuer of the bond and that of the holder thereof is that of a debtor and creditor. Bonds are highly saleable commodities3 as they are considered a safe form of investment and can be used as collateral to support loan4.

How global warming disrupts North American wildlife Research Paper

How global warming disrupts North American wildlife - Research Paper Example s like sparrows, swallows, song birds, wood peckers etc help in facilitating pollination of plants that characterise the nature of forests found in the north American region consisting of fire-plants, maple foliages, evergreen trees etc. Animals like deer, squirrels etc help in distributing seeds through dispersed food and seeds in their faeces. The migration of these agents of botanical diversity and generation may cause the forests to gradually diminish in terms of their size, structure and density. Effects of Global Warming on Bio Diversity and North American Wildlife The Wild Life Society, a 9000 member strong community of wild life professionals, produced a study on effects of global warming on wildlife, is the first comprehensive study of the impact of global warming on North American Wildlife. (Pegg 1) The work conducted by The Wild Life Society is adding to the growing body of scientific work that suggests that global warming may pose the greatest threat to biodiversity wipin g out rare and endangered species and reducing typical forests to barren land. A study by the National Wildlife Federation has projected that there will be â€Å"disruption of essential ecological processes, displacement or disappearance of coastal wetland species, significant loss of coastal marshes and disruption of alpine and Arctic ecosystems† (Wetkit News 1) Some of the Salient finding s of the study conducted by the NWF includes: The report's major findings include: A Projected rise in the sea level due to global climate change. This may cause some wildlife species to abandon their habitat in search of inland areas or disappear entirely if their lowland wetlands are rapidly eroded by the sea. "Even a small amount of warming may eliminate some wetland plant and animal species in alpine... This paper stresses that the threat to wildlife is more visible further up the latitudes in the regions of Alaska, British Columbia, and Northwest territories etc. Small changes in temperatures lead to magnified effects in terms of ecology shift, higher death rates of animal species and abandoning of habitat. This report makes a concluiosn that out of all the species found in the places further up the latitudes in the cold and arid regions of Alaska and Canada, the polar bear and some seal species are the most threatened. It has been forecasted that these two species may be the first to become extinct if global warming continues to affect the ecology. Moreover the forecast given by scientists and researchers did not take into account the adverse and extent of damage to ecology due to climatic imbalances. The study on North American Wildlife by National wildlife Foundation, an organisation dedicated to research and progress on wildlife conservation, spells out a certain threat. The author talks that the radical change in climatic conditions will affect the habitat and living conditions of virtually every species. As temperatures increase, these species will move up the latitudes in search of cooler areas. The shift of the range of habitat and animal life that depends on them will shift nor thwards. This means that species of animals would have to shift northward to continue living in a favourable environment. Many species in this process will become extinct due to lack of a habitat.

Canadian Chocolate Bar Market Essay Example for Free

Canadian Chocolate Bar Market Essay •Increase in cost for manufacturing such as packaging or ingredients. Chocolate bars are thought of as impulse buys, which means they require no thought. This is due to how inexpensive they are. However, if an ingredient such as sugar was to rise drastically, so will the cost of the chocolate bar therefore changing the buyers perspective on the product class. Social, Demographic Trends: •Although chocolate bars are thought to have been more enjoyed by a younger consumer, crispy crunch has always focused towards older demographics. This is shown through their mature packaging commercials. Healthier Living: •Consumers are now watching what they eat, and want to avoid products that contain ingredients that have become deemed as fattening. Technology: •Internet advertising is at an all time high, and consumers are attracted to products that they can get more information on over the Internet. Also, buzz promotion can be created efficiently via Internet. Political: •French/English Packaging •In Canada it is illegal not to have both English and French writing on the packaging. Ingredients: •All ingredients must be labeled on the packaging. Market Analysis Total Canadian Size and growth: •From 1996 to 2000, the chocolate market enjoyed a total growth rate of 19.1% with retail sales in 2000 producing a whopping $13.7 billion. Competitive Analysis Market Trends: •Hershey Canada is one the largest competitors in the chocolate bar market. Hershey brands have a strong market value and a long history dating back to 1903. Hershey Canada owned three of the top five chocolate bars sold in 2000 to 2001. Hersheys three principle brands held fifteen percent of the Canadian market share. Hersheys brands, Reese Brand, and Hershey Milk Chocolate gained 0.9 percent market share in 2000-2001. Hershey brand Oh Henry lost 0.3 percent market share but still holds the number four spot in market share value. Hershey Canada has strong brand recognition, and loyalty. •Nestle Canadas three principle brands, Kit Kat, Coffee Crisp, and Smarties represented 13.4 percent of the Canadian market in 2000-2001. Nestle has a considerable market share and strong brand insistence however only one brand gained market value. Kit Kat, Nestle principal brand gained four points surpassing Cadburys Caramilk. Kit Kat now represents the second largest piece of the market at 5.4 percent. Coffee Crisp was stalemate at 4.2 percent of market share. Nestle Smarties lost 0.3 percent of market value now ranked ninth out of the top ten chocolate bars in the Canadian market, leaving only Effems Mars behind it. •Effem Foods has two brands ranked in the top ten chocolate bars in the Canadian market, Mars and MMs. Effems two principle brands represents 8.2 percent market share. Effems Mars and MMs both lost an accumulated 0.9 percent of market share in 2000-2001. Market Analysis: •Hershey Canada, Reese Brand, represented 6.3 percent of the Canadian chocolate bar market share in 2001. Reese brand targeted young children the ads have a youthful orientation and show kids having fun eating the bar(Crunch, Crispy Case). Reese Brand was creating strong brand insistence by penetrating younger consumers. Reese used point-of-purchase materials to attract the impulse consumer. Reese also employed the leadership positioning strategy; Reese showed their product as a preferred choice among children. Hershey Milk Chocolate and Oh Henry both have a strong brand loyalty due to their insistent customer base that had been developed over years. •Nestle Canada, was a leader in the Canadian Chocolate bar market due to strong market penetration and position on the market. Nestle Smarties used the image positioning strategy. Nestle used image positioning to differentiate Smarties from Effems MMs. Nestle claimed to have a larger assortment of colours. Smarties used humour appeal to attract customers to save the red Smarties until last. Kit Kat was Nestles leader in market share representing 5.4 percent. Kit Kats target market was early twenties to late thirties. Kit Kat applied the lifestyle position strategy on the market. Give me a break of that Kit Kat Bar this slogan was used by Nestle to imply that a Kit Kat bar would be the best chocolate bar to enjoy while on a break. •Effen Foods brands Mars, and MMs both had a large market share and strong Brand loyalty in 2000-2001. MMs used Head-on positioning to penetrate and differentiate themselves from the market. They melt in your mouth, not in your hand that slogan was a direct blow to Smarties. Effen is implying that the quality of their product is better than the competitors. Target Market Analysis Demographic profile: •Age: 15-24 Gender: males, females Education: High school, College, University Occupation: Part-time, or new career opportunity Household: either living with parents, or living with a spouse Geographic profile: •Urban location of customers, allowing the customers to more easily access the product. •Packaged in English and French writing. Psychographic profile: •Activities: Going out with friends, girlfriends. Playing sports, videogames, watching movies. •Interests: Doing well in school, finding job/career opportunities for future, having fun enjoying time with friends/family. •Opinions: Would like a clean, safe environment. Consumer behavior profile: •Personality: Ideal Self Consumers as they see how they would like to be. It is what they aspire to. •Attitudes: More liberal minded consumers, show more of a selective exposure. Product Analysis Sales Volume Trends: •Between 1989 and 1990, it jumped seven places to become the number one brand in the nation. •More recently however, the Crispy Crunch Brand has fallen off the top ten chocolate bar brands to 12th place. Market Share Trends: •Old established brands continue to lead the pack in popularity; brands like Kit Kat, Oh Henry, Coffee Crisp and Smarties all date back to the 1950s and 1960s. •Reese Brand holds 6.3% of the market share, up from a year ago Current Channels of Distribution: •All the leading brands are available in the same locations: •Convenience stores •Drug stores •Grocery outlets •Vending machines •Discount stores •Marketing Communications (Historic) •The success from the early 90s was attributed to an advertising campaign •Targeted a slightly older audience of older teenagers and young adults in their early twenties rather then youth under the age of 16. •The strategy worked very well and there were several ads in the campaign. S.W.O.T Analysis Brand Strengths: (Internal) •Crispy Crunch contains a combination of chocolate and peanut brittle that offers a unique taste to consumers that other chocolate bars do not offer. Also with the image of being to good to share Crispy Crunch still has the potential to make its mark into top 10 Canadian brands by pushing the product into more advertising to make consumers more aware of its presence in the market. Weaknesses: (Internal) •Although Crispy Crunch has had a successful campaign for a period of time, other brands that Cadbury have released like Caramilk have been a little more dominant in the market. It is possible that maybe Cadbury did not pay enough attention toward the Crispy Crunch campaign, which may result in the reason for its fall behind in the overall market. Opportunities: (External). •Cadbury can use many forms of advertising their product these days as long as the presentation is executed properly. For instance, the Crispy Crunch brand has been known to add sexual situations in order to promote their product towards 15-25 year old people. If the campaign goes about with the same image or chooses to take a diverse approach to the market to recreate the image of the brand, window is still open for opportunity which either choice. Threats: (External). •Cadbury must be able to create or revise a marketing mix that would keep a strong stand in the market against the big competition from Nestle and Hershey who both have very successful campaigns for their chocolate products. Positioning Statement. • A Crispy Crunch Bar contains the grouping of chocolate and peanut brittle that offers distinctive and delectable flavor. Eat your Crisply crunch bar before somebody eats it for you! the only thing that tastes better than my Crispy Crunch, is someone elses Crispy Crunch. Target Market Definition. •Males and females 15-24 years old, who are currently working and make time for going out with friends and family. They are infrequent users because they are health conscious and may be into another brand.

Discuss The Importance Of Ethics And Social Responsibility

Discuss The Importance Of Ethics And Social Responsibility Ethics also known as moral is determined by the class of philosophy to addresses about morality i.e. concepts such as good vs. bad, right vs. wrong and matters of justice, love, peace and virtue. The term is used to indicate how individuals or organization choose to conduct themselves in relation to universal moral behavior and actions. Ethics involve choosing actions that are right and proper and just. The individual behaviour can be right or wrong, proper or improper and the managerial or individual decisions can be fair or unfair. Ethics are vital in businesses and all aspects of living. The foundation of society is built on Ethics. Without ethical principles a business/society is bound to be unsuccessful sooner or later. Business Ethics look at ethical philosophy , moral or ethical problems and deal with issues concerning the moral and ethical rights, duties and corporate authority between a corporation and its shareholders, workers, clients, media, government, provider and dealer. Ethics are connected to all discipline of organization including accounting information, human resource management, sales and marketing, fabrication, logical belongings information and talent, global business and financial system. Social responsibility can be defined as the responsibility of the organisation to operate in ways that provides both its individual benefit like making a profit and also the benefit of its stakeholders- those people and groups who are affected in one way or another by the behaviour of the organisation. For example, an industrial chemical plant has a responsibility not only towards its customers, but also towards the shareholders and the board of directors, and to those people who live in the surrounding area. This responsibility can be negative, meaning there is exemption from blame or liability, or it can be positive, meaning there is a responsibility to act beneficently. Lets take an another Example, in corporate company a chief executive make expenditures on reducing pollution beyond the amount that is in the best interests of the corporation or that is required by law in order to contribute to the social objective of improving the environment. There are lot many benefits to any o rganisation of being social responsible. First and foremost benefit to organization is that to ensure the customers, suppliers and the local community knows what you are doing. Publicity like this can be a key part of using CSR to win contracts. People want to buy from businesses they respect. Through this way your business reputation will be growing day by day and it encourage customers to stay with you and do business with your company. Compare and contrast the difference between ethics from a personal perspective to one established viewpoint of ethics from an organisational perspective. Personal perspective view of ethics Peoples lives are built on moral foundation of personal ethics. They support in conclusion making, guides people to contribute measures that helps to meet their inner moral principles. Ethics are used by people in solving problems in everyday life and also help for determining correct versus incorrect. Ethics are not absolute rules but they are developed during life based on range of factors. Defining personal ethics are a difficult venture for many people as they think their inner voice is all the ethical guidance they require. Perception plays a great role in what one finds ethical. By organisation view, ethics plays a vital role that defines the way of representation, way of talking, body language, attitude etc. The lack of personal ethics gives a negative response in managerial processes. For example, if a company is launching the product with risk taking, then the manager should be fully ensured with correct way of personal ethics, as the product may be failed to attract custome r if marketing manager lacks in personal ethics. So, it is clear that personal ethics makes a man to take a right managerial decision. A standard way of understanding ethical decision-making is to understand the philosophical basis for making these decisions. People and organizations need each other.The written and unwritten codes of principles and morals that administer decisions and actions inside a business are known as Business Ethics. In the Corporate world, the organizations traditions sets principles for determining the differentiation involving excellent and dreadful judgment making and manners. Discuss four benefits and four disadvantages of social responsibility to an organisation. Benefits of social responsibility Providing good value for money If the management and workers of the organization are well social responsible for internal and external environment of the organization then it would result in best productivity and obviously the good image of the organization. The biggest power of the any organization among all resources is the human resource thats why if human resource is so well behaved with good ethical ways the value of any organization will be good enough. Broadening the futuristic concept of business If the organization is giving best output to the public demand satisfying their needs with latest trends and technology, it means that the business of the organization is good and as public response is excellent the organization would have better future aspects. This all happen due to the organizations social responsibility towards their employees and environment factors. Also workers stay longer if the business has high-quality status. For example, MC Donalds is giving best variety of food in hygienically manner, where all the perception of individual match such as price, food quality, taste etc. Their business is so good that we can find its outlet anywhere in the world. MC Donalds is popular because they are socially responsible to the environment and for their work. Â ·.Good relationships with local authorities help doing business easier. Disadvantages of social responsibility towards organisation Everything has some prons and crons, similar to social responsibility where so many people argued on the benefits and disadvantages of social responsibility. First the most important is that the organization is running for profit maximization mostly, the social responsibility shows the fundamental misconception of the character and nature of a free economy. Business functions are moreover economic rather than social if come to the practical way and it is judged by economic criteria alone. This point of view comes to the employees mind most of the time leading to not to concentrate much in their work which automatically results in bad productivity. The role of corporation is to make a profit and maximize social welfare through the efficiency of the employees. In some cases where employees are not much social responsible for the organization than it would be very difficult for the managers or corporation to do the best out of the work and lead the group, resulting in bad image of the organization and bad internal environment There is the concern for the efficient use of national resources, because of social costs; profitability is not necessarily the best measure of effectiveness which affects the organization goal. Lack of interest of the employees towards social responsible in their business also not good for the organization Competency sometimes makes the stake holders to go beyond the limit forgetting their social responsibility that harm the nature and organization too. Being socially responsible costs organisations money, and sometimes the bill is huge. Therefore the organization think to do for profit maximizing rather than be social responsible. Discuss social responsibility barriers that inhibit an organisation Barriers that inhabit an organization Social responsibility has certain costs. Its not the natural thing to be responsible. Greed and selfishness work against social responsibility. When greed and selfishness become higher values, social responsibility goes out the window. One of the problems with our culture is that we worship wealth. People who have a lot of money are heroes to us and we strive to emulate them. We see wealth and power as an indicator of merit and virtue. But people who are rich and want to be richer, and corporate and industrial leaders whose jobs are to put the prosperity of their companies at the top of their priorities, often trivialize social responsibility, and this sets the tone for the whole culture. In social responsibility every individual in the organisation is not social responsible towards the work, it depends upon the people behaviour and motivation level within the organisation. Today every people think about wealth rather than social responsibility that they possess towards the organisat ion. This is the barrier in the organisation. For e.g.:- in an organisation if certain facility is lacking for the staff then staff will suffer and this management must be think which in reality they dont. This lacking of facility may affect the work out going on within the organisation. Flow of information in the organisation should be well enough to avoid any conflicts between the staff but it arises due to the problems that every employee are not social responsible. A vendor to the company first think towards the money he/she will get from doing particular kind of work.

The Genius of John Bardeen

Genius is more often than not measured by Intelligence Quotient (â€Å"I. Q. †). This should not be the case. It would be better to attribute the label genius to someone who was able to beat the odds and used everything in his power to contribute to progress and in making life a much more blessed experience. The distinction of being a genius must only be given to those whose body of work has surpassed the test of time. If indeed achievements and great works is the trademark of a man of great intelligence then it would not be difficult to heap accolades and to celebrate the genius of John Bardeen.Not only is he brilliant and possessing a mind that can beat a roomful of supercomputers but he is also self-effacing and not one to tell the world of his exploits. In fact it will be shown later that when he learned that he was one of the recipients of 1957 Nobel Prize for Physics, he could not believe he deserved to receive such a life changing award. If this was not enough, Bardeen won the Nobel Prize in Physics less than two decades later. His theory about superconductivity assured him of a place among the greatest scientists who ever lived.Without John Bardeen’s pioneering work on transistors and superconductivity, there would never have been a world wide web, interconnectedness in the blink of an eye and an ultra-efficient and comfortable lifestyle available for those living in the 21st century. The world today may very well be a different place if Bardeen was not born and allowed to develop into a formidable intellectual force. The following pages will provide a basic understanding of how one man help change the world. Building a CareerA great foundation is the assurance of a solid structure with an integrity that can withstand tremors and other pressures. If this analogy of building structures can be applied to life then it can be said that John Bardeen prepared a secure foundation for a great career that would change the course of history. All gre at careers – especially in engineering – must start with great education. Mr. Bardeen went to the University High School in Madison, Wisconsin for a number of years and then went on to graduate from Madison Central High School in the year 1923.Then he took up a course in electrical engineering at the University of Wisconsin. In the said university, Bardeen took up the extra challenge of adding in extra work in mathematics and physics. If this is not enough he went to work – while still an undergraduate student – in the engineering department of the Western Electric Company at Chicago. He graduated with a B. S. in electrical engineering in 1928. But he did not leave his beloved university just yet and he continued on as a graduate research assistant in electrical engineering, a task which he focused on for the next two years of his life.In this two years he devoted himself to the study of mathematical problems in applied geophysics and also the phenomenon of radiation in antennas (see Nobelprize. org). After serving under the U. S. Navy in World War II, Bardeen, â€Å"†¦was hired by Bell Laboratories, a high-tech communications and electronics research plant† (Haven & Clark, 1999, p. 22). It is in this environment and in this scientific community where Bardeen was able to showcase his talents.But Bardeen was not only keen in showing the what he can do; he is also very much willing to share what he knows to others. He served as a Junior Fellow at Harvard University and also worked as assistant professor of physics at the University of Minnesota (Haven & Clark, 1999, p. 24). Contributions In the beginning of this study the proponent submitted the idea that genius should not be only measured through intelligence quotient alone but also on the ability of the person to create something worthwhile; in other words to contribute to the forward progress of mankind.This will show that the high IQ person is not simply a machine able to crunch complicated sets of numbers but also a complete human being able to touch lives and to work with others. In this category of super achievers one can include John Bardeen not only because he has the machinelike prowess to solve complicated problems but also because he was well regarded by his peers and well respected beyond the community where he first nurtured his genius in Wisconsin. The first major contribution of Bardeen was to crack the transistor puzzle.Together with a team of scientists – Walter H. Brattain and William Shockley – he was able to explain semiconductors and the transistor effect (see Nobelprize. org). Just to show a basic idea of what this discovery has meant to human history here is Bardeen’s contribution in a nutshell, â€Å"The transistor has been the backbone of every computing, calculating, communicating and logic electronics circuit build in the last 50 years† (Haven & Clark, 1999, p. 21). For his work he shared the 19 56 Nobel Prize in Physics.His second major contribution was to provide for a very enlightening explanation of superconductivity. In the words of Haven and Clark, â€Å"Bardeen won his second Nobel Prize for elucidating the theory of superconductivity, which has been called one of the most important achievements in the theoretical physics since the development of quantum theory† (1999, p. 21). Thus, in 1972 Bardeen became a double Nobel laureate. He shared the award with Leon N. Cooper and J. Robert Schrieffer for the theory of superconductivity.From then on others were able to build on this new understanding and at present allowed many to experience that, â€Å"Superconductivity at higher temperatures has led to such feats as frictionless, ultrafast trains lifted magnetically above their rails†¦Ã¢â‚¬  (Haven & Clark, 1999, p. 21). Conflicts In every major endeavor and in every significant discovery, controversy and conflicts are almost inevitable as night follows day. More often than not conflicts are coming from the outside as people unable to fully grasp the new scientific breakthrough would question its relevance to society.In the case of John Bardeen the conflicts he experienced did not come from his external environment but surprisingly it came from within; from within himself and from within their own community of scientists. This inner turmoil was explained by Hoddeson and Daitch (2002, p. 2-3) as follows: 1. Bardeen was unsure of the true worth of transistors in the larger scheme of things. 2. Bardeen was not agreeable to the fact that William Shockley was considered as the co-inventor of the transistor and share the Nobel Prize in 1956.It is interesting to expound on the second statement for it would strengthen the thesis that a true man of genius must be able to work harmoniously within a community, within a group of individuals to be considered as a man of great intellectual stature and not merely a flash in the pan talent that would p rove useless in real life situations. A deeper look at the issue would reveal that Shockley was not able to contribute a significant theory or solution that led to the discovery of the transistor action. It was purely the work of Bardeen and Brattain.Hoddeson and Daitch reveal that, â€Å"†¦it was Shockley, rather than Bardeen and Brattain, who received wide recognition for the discovery. Even today, popular magazines sometimes credit Shockley alone with the invention† (2002, p. 2). Even if Bardeen knew the inside information as to what really happened within the Bell laboratories where the â€Å"transistor phenomena† was fully understood, it was a testament to his great character that he did not make a scandal out of it and at the end allowed Shockley to share the fame and the glory together with Brattain. LegacyAside from having great mind and the capacity to touch lives, one of the standards upon which true genius must be measured against is legacy. Legacy is w hat is left when the hype dies down and when the passage of time has truly tested the value of a person’s work. With regards to the legacy left behind by Bardeen this is what Jim Turley has to say: Few things have altered modern life as much as the discovery of semiconductors †¦ Modern electronics have completely changed the way we talk with each other †¦ It has changed medical research, entertainment, record keeping, travel, and exploration.There’s almost no business, profession, or industry that hasn’t changed since the introduction of solid-state electronics in the last 50 years (2003, p. 2). If having a brilliant mind, capacity to work under pressure and to share recognition with a group of equally talented personnel, and a body of work that has changed history is the measure of true genius then there are only a few who can match John Bardeen in this respect. Works Cited Haven, Kendall & Donna Clark. 100 Most Popular Scientists for Young Adults: Bi ographical Sketches and Professional Paths.Englewood, CO: Libraries Unlimited, Inc. , 1999. Hoddeson, Lilian & Vicki Daitch. True Genius: The Life and Science of John Bardeen. Washington, D. C. : Joseph Henry Press, 2002. Nobelprize. org. John Bardeen: The Nobel Prize in Physics 1972. Available from Accessed 20 July 2007. Samuelson, Bengt & Michael Sohlman. Nobel Lectures in Physics. New Jersey: World Scientific Publishing Co. , 1998 Turley, Jim. The Essential Guide to Semiconductors. New Jersey: Pearson Education, Inc. , 2003.

Gendering Biology and Sociology Essay

Can we define gender both biologically and sociologically? That question is at the forefront of the continuing debate between cultural and scientific researchers. The issue stems from a fundamental difference in how to explain gender definitions in an era of fluid identities and particularized conceptions of the body. This brief essay will outline the path this debate has taken in an attempt to see where it will take us in the future. Biologists and sociologists see the world in different ways. Biologists tend to believe that the natural world should form the basis of our understanding about life while sociologists believe that culture is the primary driving force that creates our collective knowledge. In this way, a gap has been created between two competing theories about what and how gender should be defined. For example, sociologists critique the biological basis of gender because they speculate that cultural practices influence what type of biology to undertake. Physical appearance, chromosomal sequencing, personal psychology, social norms, and many other factors are at work when we ask questions that transcend sexual difference and enter the realm of gender identity definitions. In the realm of sports, we have seen how outdated scientific gender testing has proven to be unreliable in determining what counts as a male or female. As chairman of the International Olympic Committee medical commission Arne Ljungqvist notes, â€Å"Sometimes, fingers are pointed at particular female athletes, and in order to protect them, we have to be able to investigate it and clarify. † (Thomas). In order to traverse this widening gap, sociologists and biologists need a common language and framework if we hope to come to a deeper understanding of gender and how it will influence our lives. Works Cited Thomas, Katie. (2008). A Lab Is Set to Test the Gender of Some Olympic Athletes. July 30, 2008. The New York Times. Retrieved January 9, 2009 from http://www. nytimes. com/2008/07/30/sports/olympics/30gender. html

Test Anxiety in University

Test Anxiety in University Free Online Research Papers TEST ANXIETY AS A FACTOR IN UNDERGRADUATESACADEMIC PERFORMANCE AT THE NIGERIAN PREMIER UNIVERSITY OF EDUCATION Abstract This study investigates the test anxiety as a factor in academic performance. Four hundred students were randomly selected from four Colleges in the University: (1) College of Applied Education Vocational (2) College of Humanities (3) College of Social Management Studies and (4) College of Applied Sciences. One hundred students were randomly selected from each College. Students Test Anxiety Questionnaire (STAQ) was designed and used to collect data. While current grade Point Average score used as measure of academic performance. Data was analysed using Pearson Product Moment Correction and Student t test. The result of the data analysis showed a strong negative correlation between test anxiety and academic performance. The level of test anxiety experience by male and female students also differs significantly. Regular periodic programmes to reduce test anxiety should be organised by the University Counselling Centre, while parents should help female students to prepare better fo r examinations in order to reduce test anxiety. Background to the Study Anxiety is described as the apprehensive anticipation of future danger or misfortune accompanied by a feeling of dysphasia or somatic symptoms of tension. (Stanton,1993). From another perspective, anxiety is a feeling of unease. Everybody experiences it when faced with a stressful situation, for example before an examination or an interview, or during a worrying time such as illness. It is normal to feel anxious when facing something difficult or dangerous and mild. Anxiety can be a positive and useful experience. Spielberger and Sarason (1998) defined test anxiety as a situation-specific trait that refers to the anxiety states and worry conditions that are experienced during examinations. The level of anxiety can fluctuate over time in response to both internal and external stimulation. Naylor (1994) observed that test taking anxiety is significant for both educators and students While, Tobais (1985) suggested that test anxiety may be a function of poor study habits or deficient skills of test-taking which themselves have deleterious effects on academic performance. Observable behaviours of anxiety can be noticed during the completion process of a questionnaire presented to the students or participants. Some of those behaviours might include perspiration, excessive moment and questioning of instructions. These behaviours are often compatible with the classification of high and low test anxiety groups (Smith, 1995). There are also stable individual differences in the degree to which anxiety is manifested in any given situation. A disruption or disorganisation of effective problem solving and cognitive control, including difficulty in thinking clearly, can also lead to test anxiety (Freidman Bendas-Jacob 1997). There are a lot of factors that contribute to the development of test anxiety. Oderinde(2000) explained that inadequate preparation on the part of students couple with attendant companion of fear of failure have affected academic performance and examination misconduct. Another factor is self-concept, which is the overall sum of self-referent information that an individual has processed, stored and organised in a systematic manner (Spielberger Sarason 1989). The self-concept can be viewed as an image of oneself. Worry of suffering a reduction of the self-image, particularly in the eyes of peers, leads to higher test anxiety level (Friedman Bendas-Jacob (1997). Self-awareness is another factor of test anxiety. It is defined as the feeling of being observed or evaluated by others. A more commonly recognised factor of test anxiety is the classroom climate. People, in general, have the need to manipulate and control their surroundings in order to produce a comfortable environment. In a classroom setting, however, there may not be the opportunity to control the surroundings. This creates the possibility of different level of arousal. The degree of arousal in relation to ones adaptation level will determine whether a positive or negative affective experience will result (Spielberger Sarason1985). If an individuals experience is negative, then the test anxiety will be higher leading to lower performance. Invariably, if an individuals experience is positive, then the test anxiety level will be lower leading to higher performance. Mauduabum (2001) also noted that the desire to satisfy parental expectations and ensure that future plans are not marred creates anxiety and tension, all of which make cheating attractive to students and often result in poor performance. It is also gathered that sex differences is observed whereby females rather than males tend to experience high anxiety. Overall, it is important to consider motives, aptitudes, cognitive assessments of the task, and past experience when analysing test anxiety and how it relates to academic performance (Heather April 2002). Test anxiety in general is expected to have a negative effect on academic performance (Smith 1995). While, stressful testing conditions arouse high anxiety which in turn arouses defensive processes and prevents the person from acknowledging the anxiety. Statement of the Problem The study investigated test anxiety as a factor in undergraduates academic performance. Research Questions (1) What is the relationship between students test anxiety and level of academic performance? (2) Is there any significant difference between male and female students level of test anxiety? Methodology This is a descriptive study of the ex-post facto type in which the researcher simply conducts an objective study of factors, which already exist. None of the variables was manipulated. Participants The participants consisted of 400 students drawn from the four Colleges in the Universities that is, 100 students each randomly selected in the College of Applied Education and Vocational Technology, College of Humanities, College of Social Management Studies and College of Applied Sciences. Instrumentation Students Test Anxiety Questionnaire (STAQ) developed and validated by the researcher was administered, while their currents Grade Point Average was used as measures of academic performance. The questionnaires are five-point Likert Scale type. The students were asked to indicate their feelings by ticking Strongly Agree, Agree, Undecided, Disagree, and Strongly Disagree in front of each item in the STAQ. The questionnaires consist of 16 items. Students were not asked to indicate their names on the questionnaires so as to make responses anonymous. The split-half reliability coefficient of STAQ is 0.732 Data Analysis Data analysis was carried out using Pearson Product moment correlation, and t-test analyses. Research Question 1 What is the relationship between students test anxiety and level of academic performance? Test Anxiety Academic Performance Pearson Correlation Test Anxiety Academic Performance Sig. 2 tailed N 1.000 -0.83 .041 400 -0.83 1.000 .041 400 Table 1 above shows a very high negative correlation between test anxiety and academic performance (r= -0.83, P

Sadistic Killer and Rapist Charles Ng

Sadistic Killer and Rapist Charles Ng Charles Ng and Leonard Lake rented a remote cabin in the 1980s near Wilseyville, Calif., and built a bunker where they imprisoned women and used them as sex slaves, torturing and murdering them, their husbands, and children. When the spree ended, police connected Ng to 12 murders, but they suspected that the real number was closer to 25. Ngs Childhood Years Charles Chi-tat Ng was born in Hong Kong on Dec. 24, 1960, to Kenneth Ng and Oi Ping. He was the youngest of three children and the only boy. His parents were thrilled that their last child was a boy and showered him with attention. Kenneth was a strict disciplinarian and kept a sharp eye on his son, constantly reminding Charles that a good education was his ticket to success and happiness. But Charles was more interested in martial arts so he could follow in the footsteps of his hero, Bruce Lee. Charles attended parochial school, and Kenneth expected him to do all his assignments, study hard, and excel in his classes. But Charles was a lazy student and received low grades. Kenneth found his sons attitude unacceptable and got so angry that he beat him with a cane. Acting Out At 10, Ng became rebellious and destructive and was caught stealing. He disliked Western children and attacked them when their paths crossed. When he started a fire in a classroom while playing with off-limits chemicals, he was expelled. Kenneth sent him to boarding school in England, but he was soon expelled for stealing and shoplifting and sent back to Hong Kong. College in the U.S. lasted one semester, after which he was convicted of hit and run driving but, instead of paying restitution, lied on his enlistment application and joined the Marines. In 1981 he was jailed for stealing weapons but escaped before trial and fled to California, where he met Lake and Lakes wife, Claralyn Balazs. He lived with them until Ng and Lake were arrested by the FBI on weapons charges. Ng was convicted and sent to the penitentiary in Leavenworth, Kan., while Lake made bail and went into hiding at a remote cabin in Wilseyville in Californias Sierra Nevada Mountains. The Ghastly Crimes Begin After Ngs release from prison three years later, he reunited with Lake at the cabin and they began living out Lakes sadistic, murderous fantasies, killing at least seven men (including Lakes brother), three women, and two babies in 1984 and 1985. Authorities believe the number murdered is much higher. The spree ended when Ng and Lake were seen shoplifting a bench vise at a lumberyard to replace one they had broken torturing their victims. Ng fled; Lake was stopped in a car registered to one victim with the drivers license of another victim. He was arrested and, during a break in interrogation, committed suicide after writing down his and Ngs real names. Police continued investigating. They found the cabin in Wilseyville and gruesome evidence of the murders: charred body parts, corpses, bone chips, weapons, videotapes showing sexual abuse and rape, bloody lingerie, and a bed with restraints. They also found Lakes diary, which detailed acts of torture, rape, and murder he and Ng had performed in what he referred to as Operation Miranda, a fantasy that centered on the end of the world and Lakes desire for sexual slaves. Investigators also found a bunker built partially into a hillside with a room designed as a cell so whoever was in the room could be watched and heard from an outer room. Complete details of the tapes contents were never disclosed. A Long Legal Battle Ng was charged in the U.S. with 12 counts of murder. He was tracked from San Francisco to Chicago, Detroit, and finally Canada, where he was arrested for robbery and attempted murder committed in that country. After a trial he was imprisoned and, following a six-year, $6.6 million legal battle, was extradited to the U.S. in 1991. Ng and his lawyers used a variety of legal tactics to delay his trial, but it finally began in October 1998 Orange County, Calif. His defense team presented Ng as an unwilling participant in Lakes sadistic murder spree, but prosecutors introduced cartoons Ng had drawn depicting murder scenes in the Wilseyville cabin in details that a nonparticipant wouldnt have known. They also produced a witness who had been left for dead in the killing spree but survived. The witness said Ng, not Lake, had attempted to kill him. Fast Decision From the Jury After years of delays, tons of paperwork, and millions of dollars, Ngs trial ended with guilty verdicts in the murders of six men, three women, and two babies. The jury recommended the death penalty, and the judge imposed it. As of July 2018, Charles Ng was on death row in the California Department of Corrections and Rehabilitation, continuing to appeal his death sentence. Source:  Justice Denied: The Ng Case by Joseph Harrington and Robert Burger  and  Journey into Darkness by John E. Douglas